View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_low_87 (Length: 238)
Name: NF20620_low_87
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_low_87 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 25742930 - 25743128
Alignment:
| Q |
20 |
aaaagtcacttagtttttgtaggtttgtcaatgcacataaatgcaatggcatccatttcaaactcgtacaagtaatatctaagtaacgcaggttaactaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25742930 |
aaaagtcacttagtttttgtaggtttgtcaatgcacataaatgcaatggcatccatttcaaactcgtacaagtaatatctaagtaacgcaggttaactaa |
25743029 |
T |
 |
| Q |
120 |
cctatgaaaatctttaggaagttcttgtaggttagtacatccaactagtttcaaagtttccaaattgtacagacaaccaatgctttcccgcaatatgttc |
219 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25743030 |
cctatgaaaatctttagga-----ttgtaggttagtacatccaactagcttcaaagtttccaaattgtacagacaaccgatgctttcccgcaatatgttc |
25743124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University