View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20620_low_97 (Length: 222)

Name: NF20620_low_97
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20620_low_97
NF20620_low_97
[»] chr3 (1 HSPs)
chr3 (17-211)||(1833902-1834096)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 1834096 - 1833902
Alignment:
17 aatatgtccacatcttccattgctagatctttgctctctgcttccatgtatggataatttgttccatgttgcaaaacatgaaactctgcatggtaattta 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1834096 aatatgtccacatcttccattgctagatctttgctctctgcttccatgtatggataatttgttccatgttgcaaaacatgaaactctgcatggtaattta 1833997  T
117 aatgtgattgtgataagggttgaaatctataaaaacaagtaacaaactaactacctaaagttttgtttggaaaagtttaattttgttcatctcat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
1833996 aatgtgattgtgataagggttgaaatctataaaaacaagtaacaaactaactacctaaagttttgtttggaaaagtttaattttgtttatctcat 1833902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University