View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20621_low_4 (Length: 218)
Name: NF20621_low_4
Description: NF20621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20621_low_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 40635519 - 40635305
Alignment:
| Q |
1 |
taaggattaagcttgtacaaatatcatcatgtttaatggtagggcatgagaggttctatgccaatcccaactttgtagtttttgacatagtagtatattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40635519 |
taaggattaagcttgtacaaatatcatcatgtttaatggcagggcatgagaggttctatgccaatcccaactttgtagtttttgaca------tatattt |
40635426 |
T |
 |
| Q |
101 |
ctttatatgtttatttgaaggtcctaacaaaataaattatagttttgctggatataaaaggcggtgtagattgtaa---nnnnnnnnattcctgtaatat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
40635425 |
ctttatatgtttatttgaaggtcctaacaaaataaattatagttttgctggatataaaaggcggtgtaaattgtaatttttttttttattcctgtaatat |
40635326 |
T |
 |
| Q |
198 |
aatgtgtcatgctctcgcaac |
218 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40635325 |
aatgtgtcatgctctcgcaac |
40635305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University