View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20622_high_6 (Length: 312)
Name: NF20622_high_6
Description: NF20622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20622_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 14 - 293
Target Start/End: Original strand, 2081157 - 2081436
Alignment:
| Q |
14 |
tcatcatgtgtgacttttcgtttgcttttagacataaagagtgtaggtggttatgagttgtggttgtcatgttaggtaatcggtaacatcttttttagtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2081157 |
tcatcatgtgtgacttttcgtttgcttttagatataaagagtgtgggtggttatgagttgtggttgtcatgttaggtaatcggtaacatcttttttagtg |
2081256 |
T |
|
| Q |
114 |
tttctctccttggggactatatggatttgacatttagtgtttgggatatttgagacctaaagaaacaactgttgtttctccagtattggtggagcacata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2081257 |
tttctctccttggggactatatggatttgacatttagtgtttgggatatttgagacctaaagaaacaactgttgtttctccagtattggtggagcacata |
2081356 |
T |
|
| Q |
214 |
ttgtcttgtaaaatcattcttatagattcaagggttgtccttgcttgtttttatgaatgttatgttgtgtttgtgtatac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2081357 |
ttgtcttgtaaaatcattcttatagattcaagggttgtccttgcttgtttttatgaatgttatgttgtgtttgtgtatac |
2081436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University