View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20622_low_7 (Length: 261)
Name: NF20622_low_7
Description: NF20622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20622_low_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 21 - 261
Target Start/End: Original strand, 25144280 - 25144527
Alignment:
| Q |
21 |
cgatcgtgattatgtcggtttaaaagttgaactatgatttagatgtctta---------ccggttcaatgtctagtttggtttctaaatcattagttcac |
111 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25144280 |
cgatcgtggttatgccggtttaaaagttgaactatgatctagatgtcttcaactatgatctagttcaatgtctagtttggtttctaaatcattagttcac |
25144379 |
T |
 |
| Q |
112 |
gagagaaatatcaaatgatcaatcataccaacaaagagttctaaataaatttagtggtagagatgtttgcnnnnnnnnntcttttgttgattaatgtttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
25144380 |
gagagaaatatcaaatgatcaatcataccaacaaagagttctaaataaatttagtggtagagatgtttgcaaaaaaaa--ctgttgttgattaatgtttg |
25144477 |
T |
 |
| Q |
212 |
caatatttactatgatagaacttatgacatttttctttttgtctaagaga |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25144478 |
caatatttactatgatagaacttatgacatttttctttttgtctaagaga |
25144527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University