View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20622_low_9 (Length: 244)
Name: NF20622_low_9
Description: NF20622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20622_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 20573033 - 20573270
Alignment:
| Q |
1 |
aaggtgagggatgttgataaattgaaaaaagctcttaataatatttatattagggatttcagtttgattttgaatattgctagatttg---------ata |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||| |
|
|
| T |
20573033 |
aaggtgagggatgttgataaattgaaaaaagcccttaataatatttatattagggatttcagtttgttttttaatattgctagatttgataggtttgata |
20573132 |
T |
 |
| Q |
92 |
agaatgtggaaggtttgaaggggtcgggcgataaagaaaaatgaaaagagttgtgggagaaaaaattgctcgagtagaggatggtnnnnnnnttgaggga |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
20573133 |
agaatgtggaaggtttgaaggggtcgggcgatagagaaaaatgaaaagagttgtgggagaaaaaattgctcgagtagaggatggtaaaaaaatcgaggga |
20573232 |
T |
 |
| Q |
192 |
gttgagtaggggacatgtagagagagaggggaaaaaag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20573233 |
gttgagtaggggacatgtagagagagaggggaaaaaag |
20573270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University