View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20623_low_7 (Length: 233)
Name: NF20623_low_7
Description: NF20623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20623_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 152
Target Start/End: Original strand, 9770740 - 9770873
Alignment:
| Q |
19 |
agagcacagcttaatgattctttttcaaagttttgaaaaaactctttcttttgctttggtgttgatggtatattgaataattccacaatatagtgaatca |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9770740 |
agagcacagcttaatgattcttttccaaagttttgaaaaaactctttcttttgctttggtgttgatggtatattgaataattccacaatatagtgaatca |
9770839 |
T |
 |
| Q |
119 |
aggaatcagaaagttgtgggcccgaagacacagg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9770840 |
aggaatcagaaagttgtgggcccgaagacacagg |
9770873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 87 - 133
Target Start/End: Complemental strand, 25466790 - 25466744
Alignment:
| Q |
87 |
tatattgaataattccacaatatagtgaatcaaggaatcagaaagtt |
133 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
25466790 |
tatattgaataattccacattttagtgaagcaaggaatcagaaagtt |
25466744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University