View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20624_high_8 (Length: 348)
Name: NF20624_high_8
Description: NF20624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20624_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 7e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 242 - 329
Target Start/End: Complemental strand, 24453833 - 24453746
Alignment:
| Q |
242 |
ctccctaacacttcccaaaggttcaaccaaacccgcagaaagccttcgaaaaatttgttgaagcgccgggtcttcaatccacctatcc |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24453833 |
ctccctaacacttcccaaaggttcaaccaaacccgcagaaagccttcgaaaaatttgttgaagcgccgggtctccaatccacctatcc |
24453746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University