View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20624_low_8 (Length: 348)

Name: NF20624_low_8
Description: NF20624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20624_low_8
NF20624_low_8
[»] chr2 (1 HSPs)
chr2 (242-329)||(24453746-24453833)


Alignment Details
Target: chr2 (Bit Score: 84; Significance: 7e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 242 - 329
Target Start/End: Complemental strand, 24453833 - 24453746
Alignment:
242 ctccctaacacttcccaaaggttcaaccaaacccgcagaaagccttcgaaaaatttgttgaagcgccgggtcttcaatccacctatcc 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
24453833 ctccctaacacttcccaaaggttcaaccaaacccgcagaaagccttcgaaaaatttgttgaagcgccgggtctccaatccacctatcc 24453746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University