View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20625_high_45 (Length: 230)

Name: NF20625_high_45
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20625_high_45
NF20625_high_45
[»] chr2 (2 HSPs)
chr2 (162-219)||(37304942-37304999)
chr2 (1-46)||(37304781-37304826)
[»] chr4 (1 HSPs)
chr4 (1-42)||(16825164-16825205)


Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 162 - 219
Target Start/End: Original strand, 37304942 - 37304999
Alignment:
162 cttacgcttccatttcttggatctgatgctgtgtatgacggtgataacgtttcttctt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37304942 cttacgcttccatttcttggatctgatgctgtgtatgacggtgataacgtttcttctt 37304999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37304781 - 37304826
Alignment:
1 tctgcttagttccttcctttgcttgtcatcagggtgtggacattcc 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
37304781 tctgcttagttccttcctttgcttgtcatcagggtgtggacattcc 37304826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 16825205 - 16825164
Alignment:
1 tctgcttagttccttcctttgcttgtcatcagggtgtggaca 42  Q
    ||||||||  |||||||||||||||||||| |||||||||||    
16825205 tctgcttaactccttcctttgcttgtcatctgggtgtggaca 16825164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University