View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20625_high_50 (Length: 205)
Name: NF20625_high_50
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20625_high_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 43132746 - 43132925
Alignment:
| Q |
19 |
atagtgtaccatggttgcacaaatagtcaaatacttgtagatattcctgcnnnnnnnntctataatactaactaaaaacatttaaaataaattcccctgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43132746 |
atagtgtaccatggttgcacaaatagtcaaatacttgtagatattcctgcaaaaaaattctataatactaactaaaaacatttaaaataaattcccctgc |
43132845 |
T |
|
| Q |
119 |
tttggctaggattgagaattt----tctatgtccttcacaatttcactaatagcagttttaaccatatttacagaattat |
194 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43132846 |
tttggctaggattgagaattttctatctatgtccttcacaatttcactaatagcagttttaaccatatttacaggattat |
43132925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University