View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20625_low_23 (Length: 374)
Name: NF20625_low_23
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20625_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 32 - 356
Target Start/End: Complemental strand, 44727437 - 44727113
Alignment:
| Q |
32 |
aaaatttatgaagatttctagttcctagcttttcaaacgaagtaaaagtttggagcaaaataaacaaattccccgacaaaaccgagttgaagccaagcca |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44727437 |
aaaatttatgaagatttctagttcctagcttttcaaacgaaataaaagtttggagcaaaataaacaaattccccgacaaaaccgagttgaagccaagcca |
44727338 |
T |
 |
| Q |
132 |
cttgaataccacataccaaacagtgcccgaaaaaccacatttagcaaacaaatgttcttctgtttcttggacatcattgcaacacactcaactcggaatc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44727337 |
cttgaataccacataccaaacagtgcccgaaaaaccacatttagcaaacaaatgttcttctgtttcttggacatcattgcaacacacacaactcggaatc |
44727238 |
T |
 |
| Q |
232 |
caactgttgccgaacacccctctcctccctaagttgcaccttgtccgtaggcgtgataaaagcaattgtcatgaaaaaatcaccacctttgaaggagtaa |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44727237 |
caactgttgccgaacacccctctcctccctaagttgcaccttgtccgtaggcgtgataaaagcaattgtcatgaaaaaatcaccacctttgaaggagtaa |
44727138 |
T |
 |
| Q |
332 |
attgcataaaagcaattatcccaca |
356 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44727137 |
attgcataaaagcaattatcccaca |
44727113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University