View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20625_low_29 (Length: 299)
Name: NF20625_low_29
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20625_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 281
Target Start/End: Complemental strand, 30260326 - 30260055
Alignment:
| Q |
11 |
cagagaattgattactttcagttgttacctgaatattaccaccatggtgtaatggaaaaggctcaaaattgaaggcaagcaaagctatttcagcaggttc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30260326 |
cagagaattgattactttcagttgttacctgaatattaccaccatggtgtaatggaaaaggctcaaaattgaaggtaagcaaagctatttcagcaggttc |
30260227 |
T |
|
| Q |
111 |
aactcatgatgttatatgcatgaattgtgagtatgcgacaaacaaagtttgcaaacaatcat-nnnnnnnntgataaacataaattgaaggataagaatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30260226 |
aactcatgatgttatatgcatgaattgtgagtatgcgacaaacaaagtttgcaaacaatcataaaaaaaaatgataaacataaattgaaggataagaatg |
30260127 |
T |
|
| Q |
210 |
tctaacctttggttgaatataacatcttccacgatatctctgctagagaaagggttatgcaggggctcaaaa |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30260126 |
tctaacctttggttgaatataacatcttccacgatatctctgctagagaaagggttatgcaggggctcaaaa |
30260055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University