View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20625_low_31 (Length: 291)
Name: NF20625_low_31
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20625_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 11 - 278
Target Start/End: Complemental strand, 39956272 - 39956005
Alignment:
| Q |
11 |
caaaggaagagcaaactgcaaaggttgcaccgattgcaaagagaacaccaccaaaactccatgaaagaaggaaatgcatgaagccaaaacttgagattgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956272 |
caaaggaagagcaaactgcaaaggttgcaccgattacaaagagaacaccaccaaaactccatgaaagaaggaaatgcatgaagccaaaacttgagattgt |
39956173 |
T |
 |
| Q |
111 |
taaaccaaatttacaatatcacaaacaaccaggtgcatcaccttcttctaagtcaagaaattctagctttccttcaagtcctgtatcaggtagtggaagt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956172 |
taaaccaaatttacaatatcacaaacaaccaggtgcatcaccttcctctaagtcaagaaattctagctttccttcaagtcctgtatcaggtagtggaagt |
39956073 |
T |
 |
| Q |
211 |
tctagtcttcttccaagccctaccacaccttcaacattgttctctcggttaactattatggaagatga |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956072 |
tctagtcttcttccaagccctaccacaccttcaacattgttctctcggttaactattatggaagatga |
39956005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University