View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20625_low_37 (Length: 253)
Name: NF20625_low_37
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20625_low_37 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 44 - 253
Target Start/End: Complemental strand, 5254436 - 5254232
Alignment:
| Q |
44 |
aaagagaacaatagagtcttctggttcagaccacaaagtagcaattcattgtcaacatacaaaggatgcactgtgtcat-ttgtgt-atggtcattaata |
141 |
Q |
| |
|
||||||||||| | | ||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||| |||||| |||||| |||||| |
|
|
| T |
5254436 |
aaagagaacaaaatattcttctggttcagaccacaaagt-gcaattcattgtcaacttacaatggatgcactgtgtcatattgtgttatggtcgttaata |
5254338 |
T |
 |
| Q |
142 |
tattgaagatagttactcttgtggtatcgaatacataaataacataaacaaattcttttgtgattttttaaaattaatagataaaatttcatgacataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5254337 |
tattgaagatagttactcttgtggtatc----acataaataacataaacaaattctt--gtgattttttaaaattaatagataaaatttcaggacataat |
5254244 |
T |
 |
| Q |
242 |
tatacaaataca |
253 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5254243 |
tatacaaataca |
5254232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University