View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20625_low_38 (Length: 250)
Name: NF20625_low_38
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20625_low_38 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 9220029 - 9220270
Alignment:
| Q |
13 |
aatatcaaagtatttcacctaagatcgcacccaaaacttataaaatat-gtatnnnnnnnnnncaattttaatattggtattattt---actgatatcat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||| ||||||||||||||||| | | |||||| |
|
|
| T |
9220029 |
aatatcaaagtatttcacctaagatcgcacccaaaacttataaaaaattgtagaaagaaaaaccaattgtaatattggtattatttggtattattatcat |
9220128 |
T |
 |
| Q |
109 |
gtcgggagtaggattgaatttcaaattttttagccaacaattttacaccaaaaagtgaagttctattgaaatttattatgcttaattatatcatatatat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9220129 |
atcgggagtaggattgaatttcaaattttttagccaacaattttacaccaaaaagtgaagttctgttgaaattttttatgcttaattatatcatatatat |
9220228 |
T |
 |
| Q |
209 |
gactacacaaaaacacagttgaagcatggtagcaatttaata |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9220229 |
gactacactaaaacacagttgaagcatggtagcaatttaata |
9220270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University