View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20625_low_41 (Length: 238)
Name: NF20625_low_41
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20625_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 111 - 221
Target Start/End: Complemental strand, 1050664 - 1050554
Alignment:
| Q |
111 |
ataaatcaatcaagtgttgtgttttctgtgtgtgattttttgttgttcatatggcatctcatgatatctcatctgctaagttgtcatcaatgtgtgacat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1050664 |
ataaatcaatcaagtgttgtgttttctgtgtgtgattttttgttgttcatatggcatctcatgatatctcatctgctaagttgtcatcaatgtgtgacat |
1050565 |
T |
|
| Q |
211 |
aacatacttat |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
1050564 |
aacatacttat |
1050554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 42750754 - 42750807
Alignment:
| Q |
168 |
ctcatgatatctcatctgctaagttgtcatcaatgtgtgacataacatacttat |
221 |
Q |
| |
|
|||||||||||||| |||||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
42750754 |
ctcatgatatctcacttgctaagttgtcttcaaggtgtgacataacatatttat |
42750807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University