View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20625_low_45 (Length: 230)
Name: NF20625_low_45
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20625_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 33883817 - 33883608
Alignment:
| Q |
1 |
tacaaatgcaaaagaattggttttattgctaacttcacgaatgaaataaatttccttatgtattattttctttacaaaaattgtcttatatgttagaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33883817 |
tacaaatgcaaaagaattggttttattgctaacttcacgaatgaaataaatttccttatgtattattttctttacaaaaattgtcttatatgttagaacc |
33883718 |
T |
 |
| Q |
101 |
aaagtaatttggatttttagcctttaattaatttggatggtaaccctcatagatatgtgaacaatttatcattcgtcgttatttgatgagttttacttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33883717 |
aaagtaatttggatttttagcctttaattaatttggatggtaaccctcatagatgtgtgaacaatttatcat---tcgttatttgatgagttttacttga |
33883621 |
T |
 |
| Q |
201 |
gtgtgcatattac |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33883620 |
gtgtgcatattac |
33883608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 33960437 - 33960646
Alignment:
| Q |
1 |
tacaaatgcaaaagaattggttttattgctaacttcacgaatgaaataaatttccttatgtattattttctttacaaaaattgtcttatatgttagaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33960437 |
tacaaatgcaaaagaattggttttattgctaacttcacgaatgaaataaatttccttatgtattattttctttacaaaaattgtcttatatgttagaacc |
33960536 |
T |
 |
| Q |
101 |
aaagtaatttggatttttagcctttaattaatttggatggtaaccctcatagatatgtgaacaatttatcattcgtcgttatttgatgagttttacttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33960537 |
aaagtaatttggatttttagcctttaattaatttggatggtaaccctcatagatgtgtgaacaatttatcat---tcgttatttgatgagttttacttga |
33960633 |
T |
 |
| Q |
201 |
gtgtgcatattac |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33960634 |
gtgtgcatattac |
33960646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University