View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20625_low_52 (Length: 202)
Name: NF20625_low_52
Description: NF20625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20625_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 188
Target Start/End: Original strand, 45930172 - 45930341
Alignment:
| Q |
19 |
ccaatatgtccaggtacaacagcatattgtttgtatctctcccttcttacttttttctatgcttaatcgtcaatattgtctggtacaaaagaaattccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45930172 |
ccaatatgtccaggtacaacagcatattgtttgtatctctcccttcttacttttttctatgcttaatcgtcaatattgtctggtacaaaagaaattccaa |
45930271 |
T |
|
| Q |
119 |
tactagcttgaccctcacaacccgctcttttccctctattcttttgttgagtgttgtcttccattcatat |
188 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45930272 |
tactagctcgaccctcacaacccgctcttttccctctattcttttgttgagtgttgtcttccattcatat |
45930341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University