View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20626_low_29 (Length: 257)
Name: NF20626_low_29
Description: NF20626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20626_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 242
Target Start/End: Complemental strand, 12096015 - 12095778
Alignment:
| Q |
5 |
tgtccaagaatatgttatccggaccaatcccaagatcgttgggcacagttaatttcagtatcttcgaggctgctgggaaccagttgaccggtgatgcgtc |
104 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12096015 |
tgtccaacaacatgttatccggaccaatcccaagatcgttgggcaaagttaatttcagtattttcgaggctgctgggaaccagttgaccggtgatgcgtc |
12095916 |
T |
 |
| Q |
105 |
tttcttgttcggggaaagtaagactgagttggctcatctggacttgtcgcaaaacaagttgtcgttcgacctctctaaggtggtaatgccagtgggacaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12095915 |
tttcttgttcggggaaagtaagactgagttggctcatctggacttgtcgcgaaacaagttgtcattcgacctctctaaggtggtaatgccagtgggacaa |
12095816 |
T |
 |
| Q |
205 |
ctggactcgaatttgctggtcttacggttggaaaataa |
242 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
12095815 |
ctggaatcgaatttgcttgtcttacggttggaaaataa |
12095778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 5 - 242
Target Start/End: Complemental strand, 12079375 - 12079138
Alignment:
| Q |
5 |
tgtccaagaatatgttatccggaccaatcccaagatcgttgggcacagttaatttcagtatcttcgaggctgctgggaaccagttgaccggtgatgcgtc |
104 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
12079375 |
tgtccaacaacatgttatccggaccaatcccaagatcgttgggcacagttaatttcagtattttcgaggctgctgggaaccggttgaccggtgatgcatc |
12079276 |
T |
 |
| Q |
105 |
tttcttgttcggggaaagtaagactgagttggctcatctggacttgtcgcaaaacaagttgtcgttcgacctctctaaggtggtaatgccagtgggacaa |
204 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| ||||||||||||| ||||||| ||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
12079275 |
gttcttgttcgggaaagataagactgagttggctcacctggacttgtcgcgaaacaagctgtcgtttgacctcggtaaggtggtaatgccagtgggacaa |
12079176 |
T |
 |
| Q |
205 |
ctggactcgaatttgctggtcttacggttggaaaataa |
242 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12079175 |
ctggactcgaatttgctggtcttgcggttggaaaataa |
12079138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University