View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20626_low_32 (Length: 245)
Name: NF20626_low_32
Description: NF20626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20626_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 11 - 95
Target Start/End: Original strand, 18157126 - 18157210
Alignment:
| Q |
11 |
atatcgcaacaaatacaccgaaatttcacaacacacgtaatatgttgttccagatccttccacaacgttcttttatctctctata |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
18157126 |
atatcgcaacaaatacaccgaaatttcacaacacacgtaatatgttgttccagatccttccacgacgttcttttttctctctata |
18157210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 18157293 - 18157339
Alignment:
| Q |
178 |
ctttgctgttttgaattgatttgatggcttcagaagctgaaatttct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18157293 |
ctttgctgttttgaattgatttgatggcttcagaagctgaaatttct |
18157339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 214 - 245
Target Start/End: Original strand, 18157338 - 18157369
Alignment:
| Q |
214 |
ctgaaatttcttctttatttgaaagaatgatc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18157338 |
ctgaaatttcttctttatttgaaagaatgatc |
18157369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University