View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20626_low_33 (Length: 238)
Name: NF20626_low_33
Description: NF20626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20626_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 2 - 221
Target Start/End: Original strand, 22365471 - 22365690
Alignment:
| Q |
2 |
catttatgttgtgtggtagtgagtgcacacaaatcaaaccattttgatagatacaaattatatggtccgctctttccgtcacataccatgaaagtggttc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22365471 |
catttatgttgtgtggtagtgagtgcacacaaatcaaaccattttgatagacacatattatatggtccgctctttccgccacataccatgaaagtggttc |
22365570 |
T |
 |
| Q |
102 |
tgacaaccgcaaattccacatatacctcgggcagttctcccctccccttgagatttctgctaatcaaatattttatcgctcatactcatttcaattttgc |
201 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
22365571 |
tgacaaccgcaaattccacctatacctcgggcagttctcccctccccttgagatttctgctaatcatatattttatcgctcatactcatttcaatttcgc |
22365670 |
T |
 |
| Q |
202 |
atcatcagtaatcaagtttg |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
22365671 |
atcatcagtaatcaagtttg |
22365690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University