View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20626_low_39 (Length: 222)
Name: NF20626_low_39
Description: NF20626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20626_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 21 - 208
Target Start/End: Original strand, 44347937 - 44348124
Alignment:
| Q |
21 |
catcattgttggcgtgcttgtcaagccacgtgatgatgtcttcaaaaactttttcaatgttgtcatcaggctcaccagatgttaaaccatgccacattcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44347937 |
catcattgttggcgtgcttgtcaagccatgtgatgatgtcttcaaaaactttttcaatgttgtcatcaggctcaccagatgttaaaccatgccacattcc |
44348036 |
T |
|
| Q |
121 |
agggtacaatttaattgtcttatctttgctactagctctctcatataatgccctgcttacttctgggtctgtcactgtatctgtttct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44348037 |
agggtacaatttaattgtcttatctttgctactagctctctcatataatgccctgcttacttctgggtctgtcactgtatctgtttct |
44348124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 83 - 202
Target Start/End: Complemental strand, 39562662 - 39562543
Alignment:
| Q |
83 |
tcatcaggctcaccagatgttaaaccatgccacattccagggtacaatttaattgtcttatctttgctactagctctctcatataatgccctgcttactt |
182 |
Q |
| |
|
||||||||||| |||| |||||| |||||||||||||||||||||||||| || ||||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
39562662 |
tcatcaggctccccagctgttaagccatgccacattccagggtacaattttatggtcttgtctacactactagctctctcatataatgccttgcttactt |
39562563 |
T |
|
| Q |
183 |
ctgggtctgtcactgtatct |
202 |
Q |
| |
|
| |||||||||||| ||||| |
|
|
| T |
39562562 |
ccgggtctgtcactttatct |
39562543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 103 - 150
Target Start/End: Original strand, 52216331 - 52216378
Alignment:
| Q |
103 |
taaaccatgccacattccagggtacaatttaattgtcttatctttgct |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
52216331 |
taaaccatgccacattccagggtacaatttcagtgtcttatctttgct |
52216378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University