View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20627_high_7 (Length: 285)
Name: NF20627_high_7
Description: NF20627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20627_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 49584768 - 49584993
Alignment:
| Q |
18 |
acatgtgtgtcgtaaagtggaaggttctggtagtggtggtgttgcaggttctgaaaatgaggaaggagcaaaggttgtctccaacggccggtaatggcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49584768 |
acatgtgtgtcgtaaagtggaaggttctggtagtggtggtgttgcaggttctgaaaatgaggaaggagcaaaggttgtctccaacgg----taatggcat |
49584863 |
T |
|
| Q |
118 |
tgctagcagtaacggaggcttcaaacaatgatgtcttataatgagagattgaatatgactgtcagtatctacttagcagcatatgttcatgtaaggacac |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584864 |
tgctagcagtaacgaaggcttcaaacaatgatgtcttataatgagagattgaatatgactgtcagtatctacttagcagcatatgttcatgtaaggacac |
49584963 |
T |
|
| Q |
218 |
atattaaaagacctttatgcttttgttgaa |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49584964 |
atattaaaagacctttatgcttttgttgaa |
49584993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 239 - 275
Target Start/End: Original strand, 49585179 - 49585215
Alignment:
| Q |
239 |
tttgttgaatgtgtgtttgtccaagcaaggacctttg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49585179 |
tttgttgaatgtgtgtttgtccaagcaaggacctttg |
49585215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University