View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20628_high_26 (Length: 255)
Name: NF20628_high_26
Description: NF20628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20628_high_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 62 - 218
Target Start/End: Complemental strand, 35503875 - 35503717
Alignment:
| Q |
62 |
ggatgggcattttttgggtgtagagggacctagtaagactactcactggtaagacaacgaccaatcgtcaaaatttacggagactcggataattacgtac |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35503875 |
ggatgggcattttttgggtgt-tctggacctagtaagactactcactggtaagacaacgaccaatcgtcaaaatttacggtgactcggataattacgtac |
35503777 |
T |
|
| Q |
162 |
gtttcccgttagtatgtgctaag---tgctatgctatgaatgagtccagtcatcatctca |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35503776 |
gtttcccgttagtatgtgctaagtgctgctatgctatgaatgagtccagtcatcatctca |
35503717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University