View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20628_high_36 (Length: 212)
Name: NF20628_high_36
Description: NF20628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20628_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 34 - 196
Target Start/End: Complemental strand, 53044150 - 53043988
Alignment:
| Q |
34 |
cctattcaggctagttacattaaagtttatttaaaactcacctgctaccttgccacgaccatcttcaggcattgctgcattagttgtctgaggccaagaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53044150 |
cctattcaggctagttacattaaagtttatttaaaactcacctgctaccttgccacggccatcttcaggcattgctgcattagttgtctgaggccaagaa |
53044051 |
T |
|
| Q |
134 |
tcaaatttggacctgaacatcactgtttcaaatccttccattacgcagattatctgggatttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53044050 |
tcaaatttggacctgaacatcactgtttcaaatccttccattacgcggattatctgggatttt |
53043988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 177
Target Start/End: Original strand, 15963075 - 15963178
Alignment:
| Q |
74 |
cctgctaccttgccacgaccatcttcaggcattgctgcattagttgtctgaggccaagaatcaaatttggacctgaacatcactgtttcaaatccttcca |
173 |
Q |
| |
|
||||||||||||||||| |||||||||| | | | ||| || |||||||||||||||||||| |||||| | |||| |||||||||||||||||| | |
|
|
| T |
15963075 |
cctgctaccttgccacgtccatcttcagatacagttacatcaggggtctgaggccaagaatcaaacttggacttaaacaacactgtttcaaatccttcaa |
15963174 |
T |
|
| Q |
174 |
ttac |
177 |
Q |
| |
|
|||| |
|
|
| T |
15963175 |
ttac |
15963178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University