View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20628_low_23 (Length: 299)
Name: NF20628_low_23
Description: NF20628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20628_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 282
Target Start/End: Complemental strand, 53957927 - 53957661
Alignment:
| Q |
16 |
atgggtacgtaatatttttcattcagtttcatggtgagagttacatgcaagcgttactagttatttcacttgaaattagtataacttatttaccatcata |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53957927 |
atgggtacgtaatatttttcactcagtttcatggtgagagttacatgcaagcgttactagttatttcacttgaaattagtataaattatttaccatcata |
53957828 |
T |
 |
| Q |
116 |
tatcatgtagatgccatggaagcagatattaccactgaaaagtatgtcaataaagagatggtttaaggaagtaaagctgaagaagaaagaagaacaaaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53957827 |
tatcatgtagatgccatggaagcagatattaccactgaaaagtatgtcaataaagaaatggtttaaggaagtaaagctgaagaagaaagaagaacaaaga |
53957728 |
T |
 |
| Q |
216 |
ttgcaaagagcagatgtgcatgcagcaatgtccattgcaggagttgcagcagcacttgctgcaattg |
282 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53957727 |
ttgcaaagagcagaggtgcatgcagcaatgtccattgcaggagttgcagcagcacttgctgcaattg |
53957661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University