View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20628_low_28 (Length: 250)
Name: NF20628_low_28
Description: NF20628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20628_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 18197081 - 18197262
Alignment:
| Q |
1 |
ttttgcatgattcgtcgttgatatgatggtgtttgcagctgttcaaggaattagacatgtttatgggattcttcatgattttgtgtcctgttttaatatt |
100 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18197081 |
ttttgcgtgattcctcgttgatatgatggtgtttgcaactgttcgaggaattagacatgtttatgggattcttcatgattttgtgtcctgttttaatatt |
18197180 |
T |
|
| Q |
101 |
ttgttatttttcaataatgtgtcagtttgtatttggaaaagttgttggcttttaattttgttttagtaagctaagtctaatg |
182 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18197181 |
ttgttatttttcaataatttgtcagtttgtatttggaaaagttgttggcttttaattttgttttagtaagttaagtctaatg |
18197262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 8 - 182
Target Start/End: Complemental strand, 5932914 - 5932740
Alignment:
| Q |
8 |
tgattcgtcgttgatatgatggtgtttgcagctgttcaaggaattagacatgtttatgggattcttcatgattttgtgtcctgttttaatattttgttat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5932914 |
tgattcgtcgttgatatgatggtgtttgcagttgtttgaggaattagacatgtttatgagattcttcatgattttgtgtcctgttttaatattttgttat |
5932815 |
T |
|
| Q |
108 |
ttttcaataatgtgtcagtttgtatttggaaaagttgttggcttttaattttgttttagtaagctaagtctaatg |
182 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5932814 |
tttccaataatgtgtcagtttgtatttggaaaagttgctggcttttaattttgttttagtaagctaagtctaatg |
5932740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 180 - 237
Target Start/End: Complemental strand, 5931607 - 5931550
Alignment:
| Q |
180 |
atgataatgtatatgcaacatttaaatctaatctctttccatcttcatgtatacttct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5931607 |
atgataatgtatatgcaacatttaaatctaatctctttccatcttcatgtatacttct |
5931550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University