View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20628_low_29 (Length: 249)
Name: NF20628_low_29
Description: NF20628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20628_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 112 - 238
Target Start/End: Complemental strand, 46184126 - 46184000
Alignment:
| Q |
112 |
aatgaaattatgagtgtgtgttatttaacatattgtggcatgaaatgttcacaagtttacactcgagttttaactaatagattgtctttcaattctctac |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184126 |
aatgaaattatgagtgtgtgttatttaacatattgtggcatgaaatgttgacaagtttacactcgagttttaactaatagattgtctttcaattctctac |
46184027 |
T |
 |
| Q |
212 |
ttttgataactttcactgtatatctct |
238 |
Q |
| |
|
||||||||||||||||| ||||||||| |
|
|
| T |
46184026 |
ttttgataactttcactatatatctct |
46184000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University