View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20628_low_32 (Length: 239)
Name: NF20628_low_32
Description: NF20628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20628_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 17332514 - 17332730
Alignment:
| Q |
5 |
taggaaaagaaaaagggatacggttcaacgtgtgaaaccagtttttccaggttttactaattttcattggttttccagttcactccctgtttttgttgta |
104 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17332514 |
taggaaaagaaaaagggatatggttcaccgtgtgaaaccagtttttccaggttttaccagttttcattggttttccagttcactccccgtttttgttgta |
17332613 |
T |
|
| Q |
105 |
aaacggtttttatggtcaaacggacccgacataggtccggtttccggttcaaccggctgttccggtccgatttttactaccttgggtaaatcaattttga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17332614 |
gaacggtttttatggtcaaacggacccgacataggtccagttcccggttcaaccggctggtccggtccgatttttattaccttgggtaaatcaattttga |
17332713 |
T |
|
| Q |
205 |
gttttgaatatgaatat |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
17332714 |
gttttgaatatgaatat |
17332730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 43
Target Start/End: Original strand, 9424297 - 9424330
Alignment:
| Q |
10 |
aaagaaaaagggatacggttcaacgtgtgaaacc |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9424297 |
aaagaaaaagggatacggttcaacgtgtgaaacc |
9424330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 188
Target Start/End: Complemental strand, 11181979 - 11181929
Alignment:
| Q |
138 |
ggtccggtttccggttcaaccggctgttccggtccgatttttactaccttg |
188 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
11181979 |
ggtccggttcccggttcaaccggtcggtccggtccgattttgactaccttg |
11181929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 46804305 - 46804256
Alignment:
| Q |
121 |
caaacggacccgacataggtccggtttccggttcaaccggctgttccggt |
170 |
Q |
| |
|
||||| |||| ||||||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
46804305 |
caaacagaccagacataggtccagttcccggttcaaccggctggtccggt |
46804256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University