View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2062_high_15 (Length: 287)
Name: NF2062_high_15
Description: NF2062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2062_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 279
Target Start/End: Complemental strand, 47037593 - 47037326
Alignment:
| Q |
17 |
tcaatagaccatcaacgcctataaaaaggcactgttagccatcaaaaggtactaacaatataaagtttaacctctcactct-----cttttattagcttg |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
47037593 |
tcaatagaccatcaacacctataaaaaggcactgttagccatcaaaaggtaattacaatataaagtttaacctctcactctttgctcttttactagcttg |
47037494 |
T |
 |
| Q |
112 |
agcgtaaaagtgtgtgcaaatactcacaactcgcatattgacggtcattgctccaattcgcgttgaggtagttgttgcttgacaaacaaaatcattctaa |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47037493 |
agcgtaaaagtgtctgcaaatactcacaactcgcatattgacggttattgctccaattcgcattgaggcggttgttgcttgacaaacaaaatcattctaa |
47037394 |
T |
 |
| Q |
212 |
tcactctatagcaatatgnnnnnnngaagacacttgcgttttttgtgaactatgttatcttgatgatg |
279 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47037393 |
tcactctatatcaatatgttttttttaagacacttgcgttttttgtgaactatattatcttgatgatg |
47037326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University