View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2062_low_24 (Length: 247)
Name: NF2062_low_24
Description: NF2062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2062_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 69 - 207
Target Start/End: Complemental strand, 41743125 - 41742987
Alignment:
| Q |
69 |
agtgaatctaaatctaaatatataatcactttcaccggtgcattcaattgaatcaaaataaagtttagcttgcccgaccaacattacaacttggttgctt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41743125 |
agtgaatctaaatctaaatatataatcactttcaccggtgcatttaattgaatcaaaagaaagtttagcttgcccgaccaacattacaacttggttgctt |
41743026 |
T |
 |
| Q |
169 |
gagaaaaatatgactatggtttgatgtgttgccattatc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41743025 |
gagaaaaatatgactatggtttgatgtgttgccattatc |
41742987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 41743538 - 41743478
Alignment:
| Q |
1 |
atcacgtgttaactaaagtacaaattacacttgataattggttattgtgcgggtgctttct |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41743538 |
atcacgtgttaactaaagtacaaattacacttgataattggttgctgtgcgggtgctttct |
41743478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 231
Target Start/End: Complemental strand, 41742580 - 41742552
Alignment:
| Q |
203 |
ttatcttaaagtttgttatgttttgattt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41742580 |
ttatcttaaagtttgttatgttttgattt |
41742552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University