View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2062_low_24 (Length: 247)

Name: NF2062_low_24
Description: NF2062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2062_low_24
NF2062_low_24
[»] chr7 (3 HSPs)
chr7 (69-207)||(41742987-41743125)
chr7 (1-61)||(41743478-41743538)
chr7 (203-231)||(41742552-41742580)


Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 69 - 207
Target Start/End: Complemental strand, 41743125 - 41742987
Alignment:
69 agtgaatctaaatctaaatatataatcactttcaccggtgcattcaattgaatcaaaataaagtttagcttgcccgaccaacattacaacttggttgctt 168  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
41743125 agtgaatctaaatctaaatatataatcactttcaccggtgcatttaattgaatcaaaagaaagtttagcttgcccgaccaacattacaacttggttgctt 41743026  T
169 gagaaaaatatgactatggtttgatgtgttgccattatc 207  Q
    |||||||||||||||||||||||||||||||||||||||    
41743025 gagaaaaatatgactatggtttgatgtgttgccattatc 41742987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 41743538 - 41743478
Alignment:
1 atcacgtgttaactaaagtacaaattacacttgataattggttattgtgcgggtgctttct 61  Q
    |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||    
41743538 atcacgtgttaactaaagtacaaattacacttgataattggttgctgtgcgggtgctttct 41743478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 231
Target Start/End: Complemental strand, 41742580 - 41742552
Alignment:
203 ttatcttaaagtttgttatgttttgattt 231  Q
    |||||||||||||||||||||||||||||    
41742580 ttatcttaaagtttgttatgttttgattt 41742552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University