View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2062_low_25 (Length: 245)
Name: NF2062_low_25
Description: NF2062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2062_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 40 - 84
Target Start/End: Complemental strand, 6492789 - 6492745
Alignment:
| Q |
40 |
agaattatgatgaggaaggtagtagaagctatttaggtattaggg |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6492789 |
agaattatgatgaggaaggtagtagaagctatttaggtattaggg |
6492745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 192 - 236
Target Start/End: Complemental strand, 6492633 - 6492589
Alignment:
| Q |
192 |
aagttaaaaaagagattttatcattcactatcgtaaatcttcatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6492633 |
aagttaaaaaagagattttatcattcactatcataaatcttcatt |
6492589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University