View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2062_low_27 (Length: 226)
Name: NF2062_low_27
Description: NF2062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2062_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 4 - 219
Target Start/End: Complemental strand, 2426203 - 2425989
Alignment:
| Q |
4 |
cacataagggtgtacaaacaaaaaggttgtcaatgaaacattttcccatccttcaaaaaatgaaacattttcccaaagtaaatcaccggacttttgagca |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2426203 |
cacataagggtgtacaaacaaaa-ggttgtcaatgaaacattttcccatccttcaaaaaatgaaacattttcccaaagtaaatcaccggacttttgagca |
2426105 |
T |
 |
| Q |
104 |
aaccagagcatagagtaactttcaaagttcaatatattcactcnnnnnnntcaatcttcgacttctaccataattccaataccctttatggcaattggac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2426104 |
aaccagagcatagagtaactttcaaagttcaatatattcactcaaaaaaatcaatcttcgacttctaccataattccaataccctttatggcaattggac |
2426005 |
T |
 |
| Q |
204 |
tctgacacctttgctt |
219 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
2426004 |
tctgacacctctgctt |
2425989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University