View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2062_low_29 (Length: 208)
Name: NF2062_low_29
Description: NF2062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2062_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 65 - 192
Target Start/End: Original strand, 26734675 - 26734802
Alignment:
| Q |
65 |
agaaatgaattctagttagtagactaattgacaaaataaatatcaaagttggcgtgagccgagctcagcttaacaacttagttgttaaagaaattgtgat |
164 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26734675 |
agaaatgaattccagttaatagactaattgacaaaataaatatcaaagttggcgtgagccgagctcagcttaacaacttagttgttaaagacattgtgat |
26734774 |
T |
|
| Q |
165 |
atacacggtttggtttcgaatcacctat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26734775 |
atacacggtttggtttcgaatcacctat |
26734802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University