View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2062_low_30 (Length: 207)
Name: NF2062_low_30
Description: NF2062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2062_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 17135652 - 17135818
Alignment:
| Q |
18 |
ccacttgctgtaagattcctcctgattcaattaatcatttgttaaagtcagcgtgggacacggaaacttgagatcgaaagtgtgtttggtgttcaacgat |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17135652 |
ccacttgctgtaagattcctcctggttcaattaaccatttgttaaagtcagcatgggacacggaaacttgagatcgaaagtgtgtttggtgtccaacgat |
17135751 |
T |
 |
| Q |
118 |
tgtcggcgttggacaccgatatgtgtagtaatttatattcaagaactagtttgcttatatgtccaac |
184 |
Q |
| |
|
|||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17135752 |
tgtcagcattggacaccgatatgtgcagtaatttatattcaagaactagtttgcttatatgtacaac |
17135818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 17348101 - 17347998
Alignment:
| Q |
75 |
acacggaaacttgagatcgaaagtgtgtttggtgttcaacgattgtcggcgttggacaccgatatgtgtagtaatttatattcaagaactagtttgctta |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17348101 |
acacggaaacttgagatcgaaagtgtgtttggtgtctaacga------gcgttggacaccgatgtgtgtagtaatttatattcaagaactagtttgctta |
17348008 |
T |
 |
| Q |
175 |
tatgtccaac |
184 |
Q |
| |
|
||||| |||| |
|
|
| T |
17348007 |
tatgtacaac |
17347998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 17348219 - 17348162
Alignment:
| Q |
18 |
ccacttgctgtaagattcctcctgattcaattaatcatttgttaaagtcagcgtggga |
75 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
17348219 |
ccacttgctgtaagattcctcctggttcaattaaccatttgttaaagtcagcatggga |
17348162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University