View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20630_low_24 (Length: 234)
Name: NF20630_low_24
Description: NF20630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20630_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 47952360 - 47952203
Alignment:
| Q |
1 |
ctgtcccattgaccggaatgaaacgaagaagaaagagtggtagatctgagacggccgtcgttggt---gtcgtcgttaactagatcggatctgagacgac |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||| ||||||||||||||||| || |
|
|
| T |
47952360 |
ctgtcccattgaccggaatgaaacgaagaagaaagagtggtagatctgatacggccgttgttggtatcgtcgtcgttaattagatcggatctgagactac |
47952261 |
T |
|
| Q |
98 |
cggaaatccaaaaggttgacggcggcgtgaatctgacgtgccggcgtatatctggaaa |
155 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||| || |||||||||||||| |
|
|
| T |
47952260 |
cggaaatccaaaaggttgatggcggcgtggatttgacgtgtcgacgtatatctggaaa |
47952203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 47952185 - 47952135
Alignment:
| Q |
166 |
caaaacaccggtggtagagaaggacgaacgcaggtgacgttggggattgcg |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
47952185 |
caaaacaccgatggtagagaaggacgaacgcaggtgacgtcggtgattgcg |
47952135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 208
Target Start/End: Complemental strand, 26594180 - 26594138
Alignment:
| Q |
166 |
caaaacaccggtggtagagaaggacgaacgcaggtgacgttgg |
208 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
26594180 |
caaaacaccggtggtggcgaaggacgaacgcaggtgacgttgg |
26594138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University