View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_106 (Length: 312)
Name: NF20633_high_106
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_106 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 27 - 297
Target Start/End: Complemental strand, 33203717 - 33203447
Alignment:
| Q |
27 |
ggtggattagtccggtttgaaccggagagaagagattgaagtgcgtctttgaaatgaaacgcggcacggtgtaacggtttaccggttggagatcgtagcc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33203717 |
ggtggattagtccggtttgaaccggagagaagagattgaagtgcgtctttgaaatgaaacgcggcacggtgtaatggtttaccggttggagatcgtagcc |
33203618 |
T |
|
| Q |
127 |
gttgattcagccgctctaatattgcttgagctagttgaagatgattgttatcgaaacaatcagcggcacgaataagctcttcaatgaaatcccagttgct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33203617 |
gttgattcagccgctctaatattgcttgagctagttgaagatgattgttatcgaaacaatcagcggcacgaataagctcttcaatgaaatcccagttgct |
33203518 |
T |
|
| Q |
227 |
attggtgttgttgtttggttggttattattgaaatcattaactaaatgatccagattagtgtttgtgttag |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33203517 |
attggtgttgttgtttggttggttattattgaaatcattaactaaatgatccagattagtgtttgtgttag |
33203447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University