View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_109 (Length: 310)
Name: NF20633_high_109
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_109 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 3 - 300
Target Start/End: Original strand, 25296844 - 25297143
Alignment:
| Q |
3 |
ttttgtctttttaaaactatttgtatattctatggtcaaattgaagtactctattttatcattttatgtaatttttaaattcagttaggtgtctttgttc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| || |||||||||||||||| |
|
|
| T |
25296844 |
ttttgtctttttaaaactatttgtatattctatggtcaaattgaagtactctattttatcatctcatgtaatttttaaatccatttaggtgtctttgttc |
25296943 |
T |
 |
| Q |
103 |
gtttagaggttactttggaataggttacctacaaaggataattaatttaaaagaggtattagtccacaaaattctcagttatgtat---tggtggttgcg |
199 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25296944 |
gtttagaggttactttgcaatagtttacctataaaggataattaatgtaaaaaaggtattagtccacaaaattctcagttatgtattaatggtggttgcc |
25297043 |
T |
 |
| Q |
200 |
gcaatttggaaacaacaaatcacctcnnnnnnnnaattgtaatatttttggttcgttatggcatcatgtgcttaattggttaggcttcttttcggttcat |
299 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25297044 |
gcaatttggaaacaacaaatcacct-ttttttttaattgtaatatttttggttccttatggcatcatgtgcttaattagttaggcttcttttcggttcat |
25297142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University