View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_113 (Length: 304)
Name: NF20633_high_113
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_113 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 6e-74; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 49 - 201
Target Start/End: Original strand, 15709165 - 15709316
Alignment:
| Q |
49 |
agattgaaggatagtttcatgcacattgatattaatcaaatggtgcaaaagcattcatgctctggcagccgatattacgctaagtcggaactttcaaggc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15709165 |
agattgaaggatagtttcatgcacattgatattaatcaaatggtgcaaaagcattcatgctctggcagccgatattacgctaagtcggaactttcaaggt |
15709264 |
T |
|
| Q |
149 |
gcgtgtgaatagttcatgctctcaaatatctcattttatgttactgataaaac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15709265 |
gcgtgtgaatagttcatgctctcaaatatctcattttatg-tactgataaaac |
15709316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 17 - 53
Target Start/End: Original strand, 15707101 - 15707137
Alignment:
| Q |
17 |
atgaaggtcaaatagttgcatatcatcactagagatt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15707101 |
atgaaggtcaaatagttgcatatcatcactagagatt |
15707137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 253 - 288
Target Start/End: Original strand, 15709368 - 15709403
Alignment:
| Q |
253 |
gcaaataaagtaaataactattcagactcgtaattg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
15709368 |
gcaaataaagtaaataactattcagactcgtaattg |
15709403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University