View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_115 (Length: 302)
Name: NF20633_high_115
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_115 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 2 - 280
Target Start/End: Original strand, 28521552 - 28521830
Alignment:
| Q |
2 |
atgaatttcagtgctaagaataatgggagagtgttctgatgcaccacacaccaaattttgcaacgcgcagtgagggaaaatattcatcctagcttgtgtg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28521552 |
atgaatttcagtgctaagaataatgggagagtgttctgatgcaccacacaccaaattttgcaacgcgcagtgagggaaaatattcatcctagcttgtgtg |
28521651 |
T |
|
| Q |
102 |
actaaggctctatcgagcctctcctcaaccacataattcgaactaaatttccgagatgatgtatatgcatgtccttgtagaggaacatcgatgaattcac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28521652 |
actaaggctctatcgagcctctcctcaaccacataattcgaactaaatcttcaagatgatgtatatgcatgtccttgtagatgaacatcgatgaattcac |
28521751 |
T |
|
| Q |
202 |
aatcacttactacttcccggaaaccattgaagagccattaagggtggggaacactcccttttttatcatcatttgacaa |
280 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28521752 |
aatcacttactacttcctggaaaccattgaagagccattaagggtggggaacactcccttttttatcatcatttgacaa |
28521830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University