View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_129 (Length: 275)
Name: NF20633_high_129
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_129 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 5062247 - 5061996
Alignment:
| Q |
1 |
tttggaaaattgacaacttaattttgtcactagttaagagtagcatgtcagtgctatcaagcctagtacatgttttaataactattccttgtctatggac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
5062247 |
tttggaaaattgacaacttaattttgtcactagttaagagtagcatgtcagtgctatcaagcctagtacatgttttagtaactattccatgtctatggac |
5062148 |
T |
|
| Q |
101 |
cagactaatcaaattttggtcaatgctagagcctagagtgtggcactttcattaagtttccctcctttcactttcaattgagaaaattgctcttcttacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5062147 |
cagactaatcaaattttggtcaatgctagagcctagagtgtggcactttcattaagtttccctcctttcactttcaattgagaaaattgctcttctcacg |
5062048 |
T |
|
| Q |
201 |
atcagttttgctccaacacatcagaaaaatacaaaaatattccccgacgaca |
252 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
5062047 |
atcagttttgctccagcacatcagaaaaatacaaaaatattctccggcgaca |
5061996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 19312155 - 19312105
Alignment:
| Q |
183 |
aaaattgctcttcttacgatcagttttgctccaacacatcagaaaaataca |
233 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | | |||||||||||| |
|
|
| T |
19312155 |
aaaattgctcttcttaccatcagttttgctccaaaataccagaaaaataca |
19312105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 238
Target Start/End: Complemental strand, 4861518 - 4861461
Alignment:
| Q |
181 |
agaaaattgctcttcttacgatcagttttgctccaacacatcagaaaaatacaaaaat |
238 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
4861518 |
agaaaattgctcttctcactatcaattttgctccacagcatcagaaaaatacgaaaat |
4861461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University