View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_133 (Length: 269)
Name: NF20633_high_133
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_133 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 253
Target Start/End: Complemental strand, 34512504 - 34512265
Alignment:
| Q |
14 |
gagaggactttgactttgactaggacgattctttgtacatttcttttgaagtctgttcaagaaaacacaaaatttgtttgcaagaaattttggcttcgtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34512504 |
gagaggactttgactttgactaggacgattctttttacatttcttttgaagtctgttcaagaaaacacaaaatttgtctgcaagaaattttggcttcgtg |
34512405 |
T |
|
| Q |
114 |
tttctttttacttcttcgtgttggctattgagaaagccacaactcacatttaagtgaaaactacaagagagtgtagcttttatccaaataatgatgattt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34512404 |
tttctttttacttcttcgtgttggctattaagaaagccacaactcacatttaagtgaaaactacaagagagtgtagcttttatccaaataatgatgattt |
34512305 |
T |
|
| Q |
214 |
aaggactttcaatgaaaaatgatcaatcttatcttataag |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34512304 |
aaggactttcaatgaaaaatgatcaatcttatcttataag |
34512265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 101
Target Start/End: Complemental strand, 34529271 - 34529190
Alignment:
| Q |
14 |
gagaggactttgactttgactaggacgattctttgtacatttcttttgaagtctgttcaagaaaacacaaaatttgtttgcaagaaat |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||| || |||| ||||||||||||||| | |||||||| |
|
|
| T |
34529271 |
gagaggacttcgactttgactaggacgattcttt-----tttcttttgaagtatgagcaag-aaacacaaaatttgtatacaagaaat |
34529190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University