View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_149 (Length: 253)
Name: NF20633_high_149
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_149 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 253
Target Start/End: Complemental strand, 45305820 - 45305581
Alignment:
| Q |
10 |
tccaagaatattataccattctctctccctctcttgcaattcatgtgacctagaagaagagttcattctattcagtcatcaatctcc--ctcctcaacta |
107 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45305820 |
tccaacaatattataccattctctctc------ttgcaattcatgtgacctagaagaagagttcattctattcagtcatcaatctccatctcctcaacta |
45305727 |
T |
 |
| Q |
108 |
attaacaatggttatggtttttgttattaccatctcatagcagcatcaatcaacctatatatgccatatatatgcacccttttcatttcaactagctagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45305726 |
attaacaatggttatggtttttgttattaccatctcatagcagcatcaatcaacctatatatgccatatatatgcacccttttcatttcaactagctagc |
45305627 |
T |
 |
| Q |
208 |
taggtcttgccatttttattttggtcattgccactcacttcttttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45305626 |
taggtcttgccatttttattttggtcattgccactcacttcttttc |
45305581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University