View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_168 (Length: 246)
Name: NF20633_high_168
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_168 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 36 - 244
Target Start/End: Complemental strand, 38226245 - 38226038
Alignment:
| Q |
36 |
attataagttagcttatcaactatcaacagttttttaccaaacggagccataatttggtacacttgtcaaactgttataaaatcacccccctaaaatgtg |
135 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38226245 |
attataagctagcttatcaactatcaacattttttcaccaaacggagccataatttggtacacttgtcaaactgttataaaatcaccccc-taaaatgtg |
38226147 |
T |
 |
| Q |
136 |
agtacttctattcatttaaaattgctcttccttaagtgaaagatatttccaaccacatatagacttgcatcgttgtggcactcaatatcaatgagacact |
235 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38226146 |
agtacttctattcatttaagattgcacttccttaagtgaaagattttttcatccacatatagacttgcatcgttgtggcactcaacatcaatgagacact |
38226047 |
T |
 |
| Q |
236 |
tcatctcac |
244 |
Q |
| |
|
|||| |||| |
|
|
| T |
38226046 |
tcatatcac |
38226038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University