View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20633_high_172 (Length: 244)

Name: NF20633_high_172
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20633_high_172
NF20633_high_172
[»] chr3 (1 HSPs)
chr3 (16-239)||(44056988-44057211)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 44056988 - 44057211
Alignment:
16 ctaaatttgaaagaatatggttgaagtccagttcatggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatt 115  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44056988 ctaaatttgaaagaatatggttgaagtccagttcttggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatt 44057087  T
116 tttcgtttttgctttgtttgacgaaaattagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaagtgggaat 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
44057088 tttcgtttttgctttgtttgacgaaaattagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaattgggaat 44057187  T
216 tcaagttaaattcgacggcctatg 239  Q
    ||||||||||||| ||||||||||    
44057188 tcaagttaaattctacggcctatg 44057211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University