View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_174 (Length: 243)
Name: NF20633_high_174
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_174 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 12692770 - 12692997
Alignment:
| Q |
17 |
atgaaagtctgaaaacaattgcat---tatttccactctgtttaccaacaaagattccaactatgatatgcttgtcgggattgagtatcactctttcaat |
113 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12692770 |
atgaaagtctgaaaacaattgcatgattatttctactatgtttaccaacaaagattccaactatgatatgcttgtcgggattgagtatcactctttcaat |
12692869 |
T |
 |
| Q |
114 |
ctaaccgatggtatcttcctctttccaagtgaaaatcaacataatgtttgatttcatgtactacatataaacatcatggtggttattacttcggaaggtg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
12692870 |
ctaaccgatggtatcttcctctttccaagtgaaaatcaacataatgtttgatttcatgtactacatataaacatcatggtggttattacttcagacggtg |
12692969 |
T |
 |
| Q |
214 |
aggataccagcaattggattgaaagatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
12692970 |
aggataccagcaattggattgaaagatt |
12692997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University