View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_177 (Length: 240)
Name: NF20633_high_177
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_177 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 33231236 - 33231030
Alignment:
| Q |
15 |
cagagaggtatgtctagaacttgaagacgatatatgtttcggtggtggtatccaattgtggataaaaagagttcaatccgattttcttcacttcagctac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33231236 |
cagagaggtatgtctagaacttgaagacgatatatgtttcggtggtggtatccaattgtggataaaaagagttcaatccgattttcttcacttcagctac |
33231137 |
T |
 |
| Q |
115 |
aacagcgaccaaagatttcaagttgttacaaccttcaaattcaaagagacctttgattcccatggttgtattatgacttgggttttttgttatggtaggg |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33231136 |
aacagcgaccaaagatttcaagttattacaaccttcaaattcaaagagacctttaattcccatggttgtattatgacttgggttttttgttatggtaggg |
33231037 |
T |
 |
| Q |
215 |
caggcaa |
221 |
Q |
| |
|
||||||| |
|
|
| T |
33231036 |
caggcaa |
33231030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University