View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_182 (Length: 239)
Name: NF20633_high_182
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_182 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 100 - 222
Target Start/End: Original strand, 500659 - 500780
Alignment:
| Q |
100 |
ggattagctaaagtataaaaacaatcaannnnnnnnnactaagataacttgtaaaatctctcacagacaaaaaagaaacttataaatcattttgaatttt |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
500659 |
ggattagctaaagtataagaacaatcaatttttttt-actaagataacttgtaaaatctctcacagacaaaaaagaaacttataaatcattttgaatttt |
500757 |
T |
 |
| Q |
200 |
ttatgaacgcacacatatctaat |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
500758 |
ttatgaacgcacacatatctaat |
500780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 500561 - 500608
Alignment:
| Q |
1 |
tagaatatccatctgatgatgaagctcatcgaaaaattatggtactaa |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
500561 |
tagaatatccatctgatgatgaagctcatcgaaaaattatggtactaa |
500608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University