View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20633_high_184 (Length: 238)
Name: NF20633_high_184
Description: NF20633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20633_high_184 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 193328 - 193169
Alignment:
| Q |
1 |
aaaagaataataacaataattcacaacagaataacacgtcagtcactcttgttcctattatcttaataaacctcaagtggattgaaatttatcctaaaaa |
100 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193328 |
aaaagaataataataataatttacaacagaataacacgtcagtcactcttgttcctattatcttaataaacctcaagtggattgaaatttatcctaaaag |
193229 |
T |
|
| Q |
101 |
taatatagaatttacaatttttcaatgtcgatggggtacccacgctacccatggcgggga |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
193228 |
taatatagaatttacaatttttcaatgtcgatggggtacccacgctacccatggtgggga |
193169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 193144 - 193074
Alignment:
| Q |
153 |
ggcggggacagccagacagggggagcactccccacccccgccttgccccattgacatccctacttttccct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193144 |
ggcggggacagccagacagggggagcactccccacccccgccttgccccattgacatccctacttttccct |
193074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University